Documento preparado por Ewan M Campbell, Giles E Budgel y Alan S Bowman
Gráficos en el documento original
Background
The parasitic mite Varroa destructor is considered the major pest of the European honey bee (Apis mellifera) and responsible for declines in honey bee populations worldwide. Exploiting the full potential of gene sequences becoming available for V. destructor requires adaptation of modern molecular biology approaches to this non-model organism. Using a mu-class glutathione S-transferase (VdGST-mu1) as a candidate gene we investigated the feasibility of gene knockdown in V. destructor by double-stranded RNA-interference (dsRNAi).
Results
Intra-haemocoelic injection of dsRNA-VdGST-mu1 resulted in 97% reduction in VdGST-mu1 transcript levels 48 h post-injection compared to mites injected with a bolus of irrelevant dsRNA (LacZ). This gene suppression was maintained to, at least, 72 h. Total GST catalytic activity was reduced by 54% in VdGST-mu1 gene knockdown mites demonstrating the knockdown was effective at the translation step as well as the transcription steps. Although near total gene knockdown was achieved by intra-haemocoelic injection, only half of such treated mites survived this traumatic method of dsRNA administration and less invasive methods were assessed. V. destructor immersed overnight in 0.9% NaCl solution containing dsRNA exhibited excellent reduction in VdGST-mu1 transcript levels (87% compared to mites immersed in dsRNA-LacZ). Importantly, mites undergoing the immersion approach had greatly improved survival (75-80%) over 72 h, approaching that of mites not undergoing any treatment.
Conclusions
Our findings on V. destructor are the first report of gene knockdown in any mite species and demonstrate that the small size of such organisms is not a major impediment to applying gene knockdown approaches to the study of such parasitic pests. The immersion in dsRNA solution method provides an easy, inexpensive, relatively high throughput method of gene silencing suitable for studies in V. destructor, other small mites and immature stages of ticks.
Background
The European honey bee, Apis mellifera, is vital to the pollination of agricultural and wild plants [1]. There is widespread concern about the worldwide decline in the abundance of A. mellifera [2]. The ectoparasitic Varroa mite (Varroa destructor) is the most important pest of A. mellifera and plays a central role to honey bee losses [3]. V. destructor originally parasitized the Asian bee (A. cerana) where it nearly exclusively parasitized the male bees (drones), thus making little impact on the bee colony. However, in the 1950's V. destructor shifted to the European honey bee (A. mellifera) upon which it parasitizes both the drones and female bees (workers). This shift in parasitized caste is significant because the workers make up the bulk of the adult bee population within a colony [4]. V. destructor entered mainland Europe in the 1970's, the USA in 1987 and the UK in 1992 and subsequently has been associated with the loss of millions of colonies [3]. The mite causes damage by feeding on the haemolymph of both the developing bee within brood cells and the adult bee. Mites also transmit a variety of pathogens, most notably deformed wing virus. In terms of both the number of enterprises affected and the impact of global food production, varroasis is arguably the most serious disease of livestock in any species. Previous control of V. destructor by chemical treatment is increasingly ineffective due to the development of widespread resistance in mites to the limited available acaricides [5].
There is an urgent need to harness modern molecular techniques for research into the biology and, ultimately, the control of this non-model organism, V. destructor. RNA interference (RNAi) is a gene silencing technique that is becoming an ever more powerful tool in investigating the functional role of specific genes that may be potential targets for chemotherapeutic intervention. The RNAi mechanism involves the in vivo production of small interfering RNA molecules (siRNAs) from larger introduced double-stranded RNA (dsRNA). siRNA molecules target and destroy specific mRNA, silencing the target gene at the post-transcriptional stage. RNAi has been used successfully to investigate genes in a range of invertebrate species to date including gut proteins in tsetse flies [6]; moulting genes in Tribolium castaneum [7], aquaporins in aphids [8], a putative prostaglandin E synthase in sealice [9] and extensively in ticks (reviewed in [10]). In most cases, administration of dsRNA to the invertebrate target is achieved by intrahaemocoelic injection, though immersion in solutions containing the dsRNA has been employed for nematodes and sea lice.
In this study, we assessed the feasibility of gene knockdown in V. destructor using dsRNA and determined the speed and persistence of the gene knockdown effect. Additionally, we examined less invasive methods of dsRNA administration to increase ease of experimentation and improve mite survivability. The chosen target gene was a glutathione S-transferase of the mu class. GSTs were selected for study as they have been implicated in acaricide resistance in ticks [11,12] and scabies mites [13,14] and were readily amenable to activity assays to assess the effect of gene knockdown at the translational step.
Results
Bioinformatics and phylogeny
Of the three putative Varroa GSTs, two belonged to the mu class and the other to the kappa GST class. The largest PCR product sequenced (563 bp) was termed VdGST-mu1 and the sequence deposited to EMBL [Accession No.: FR668088]. VdGST-mu1 was 100% identical to the sequence (639 bp) from a pyrosequencing project on V. destructor from the USA (Dr. Jay Evans, pers. comm.). Alignment of the protein sequence of VdGST-mu1 (213 amino acids) with other muGSTs from a variety of acari indicated that although it constituted 88% of the estimated open-reading frame, about 27 amino acids from the N-terminus were missing (Figure 1). Motifs characteristic of muGSTs were present in VdGST-mu1 as well as conserved glutathione and substrate binding sites. Notably, the mu loop in VdGST-mu1 was considerably different compared to other acarine muGSTs.
thumbnailFigure 1. Amino acid alignment of VdGST-mu1 with other acarine muGSTs. muGSTs from two mites, Sarcoptes scabiei type hominis [GenBank: AY825933] and Psoroptes ovis [GenBank: AM991140], and from two ticks Boophilus microplus [GenBank: AF077609] and Rhipicephalus appendiculatus [GenBank: AY298732] were aligned with VdGST-mu1. The boxed areas represent conserved mu-class GST motifs. Putative glutathione (black highlighted "G") and substrate (black highlighted "H") binding sites are indicated. Homology across the five acarine sequences is indicated "*" = residue identity; ":" = conserved residue and "." = semi-conserved residue.
Following alignment of the mite, tick and insect sequences, but before phyogenetic trees were constructed, the sequences were truncated by approximately 27 amino acids corresponding to those missing at the N-terminus in VdGST-mu1. Neighbour-joining, minimum evolution and maximum parsimony methods gave trees with similar topology and approximate bootstrap values and so only the neighbour-joining tree is presented. The acarine muGSTs clearly separated from the most similar insect GSTs (Figure 2). Within the acarine muGSTs, ticks and mites branched into different clades. Suprisingly, the VdGST-mu1 did not branch with the mite clade, but rather were located in a clade containing tick muGSTs. Concordantly, VdGST-mu1 shared a higher amino acid homology with ticks (e.g. Rhipicephalus appendiculatus, [GenBank: AY298732.1], 58% identity; Ixodes scapularis, [GenBank: XM_0024017051.1], 45% identity) than with mite muGSTs (e.g. Sarcoptes scabei hominis, [GenBank: AF462190.1], 38% identity; Dermatphagoides pteronyssimus, [GenBank: AY825938], 35% identity).
thumbnailFigure 2. Phylogeny of the acarine muGST family. Phylogenetic tree constructed using amino acid sequences with neighbour-joining method using MEGA (4.1). Numbers are bootstrap values. Accession and database sequence identifiers are as follows: Sarcoptes scabiei type hominis muGST [GenBank: AY825933]; S. scabiei type canis muGST [GenBank: ACX33874.1]; Lepidoglyphus destructor allergen Lep, [GenBank: AY291572]; Psoroptes ovis muGST [GenBank: AM991140]; Suidasia medanensis Sui m 8 allergen, [GenBank: AY800356]; Dermatophagoides pteronyssinus muGST-2 [GenBank: AY825939]; D. pteronyssinus major allergen Dp15 GST homolog [GenBank: S75286]; D. pteronyssinus muGST-1 [GenBank: AY825938]; Rhipicephalus appendiculatus GST [GenBank: AY298732]; Ixodes scapularis GST [GenBank: XM_002401705]; Boophilus microplus GST [GenBank: AF077609]; Dermacentor variabilis [GenBank: EU551607]; Drosophila melanogaster GST-S1 [GenBank: NM_166217]; Apis mellifera GST [GenBank: FJ374871]; Pediculus humanus corporis GST [GenBank: XM_002426842]; Tribolium castaneum GST [GenBank: XM_962313]. The tree was rooted using the S. canis var. delta-GST [GenBank: AY649788] as the outlier.
Tissue distribution of three V. destructor GSTs
RT-PCR analysis of the three cloned GSTs demonstrated marked differences in both their abundances and tissue distributions (Figure 3). VdGST-mu1 seemed to be an abundantly expressed gene that was expressed at a similar level in all three dissected tissues examined, namely synganglia, Malpighian tubules and the gut. In contrast, VdGST-mu2 is a less abundantly expressed gene that was clearly expressed in the synganglion and Malpighian tubules, but expressed at a much lower level in gut tissue. VdGST-kap was by far the least abundantly expressed of the GSTs studied, with a slightly higher level in the Malpighian tubules than the synganglion or gut.
thumbnailFigure 3. Tissue specific expression of three GSTs in V. destructor. Expression of VdGST transcripts were determined by RT-PCR in different tissues of V. destructor using mu1, mu2 and kappa VdGST-specific primers and gel loading normalized to actin. Syn = synganglion; Mal = Malpighian tubules.
Effectiveness and persistence of VdGST-mu1 knockdown in V. destructor
dsRNA was administered to V. destructor by intrahaemocoelic injection with a 20 nl bolus in distilled water and the mites then allowed to feed on bee larvae. The transcript level of VdGST-mu1 was monitored by RT-PCR at various time points over the following 3 days (Figure 4). No effect was observed at 18 or 24 hr after the dsRNA injection, but by 48 hr dsVdGST-mu1 injected mites had a 30-fold decrease of VdGST-mu1 mRNA compared to dsLacZ injected mites (P < 0.001, Figure 4B), that represented an almost total knockdown of the target transcript and which was uniform across the three individual mites tested. By 72 h, the effect of the RNAi treatment at the transcript level was still present (P < 0.001).
thumbnailFigure 4. Extent and persistence of dsRNA-VdGST-mu1 gene knockdown in adult V. destructor. (A) VdGST-mu1 transcipt levels were determined by RT-PCR up to 72 h post-dsRNA treatment and gel loading normalized to actin. (B) Semi-quantitative VdGST-mu1 RT-PCR band intensities were determined by densitometry and the relative abundance to the within-sample actin band calculated. The extent of VdGST-mu1: actin knockdown is presented as a percentage for VdGST-mu1-dsRNA injected mites and control mites injected with LacZ-dsRNA at each given time point. Data are means ± SEM (n = 3). Asterixes represent significant difference (P < 0.001) between treatments determined by Student's t-test.
Effectiveness and mortality rates of different routes of dsRNA administration
Though microinjection of dsRNA had very effectively knocked down VdGST-mu1 mRNA levels (96 ± 3.7%, n = 4, Figure 4B), such injection techniques were laborious, required specialised equipment and led to high mortality rates in the mites (50% survival, n = 62). Alternative, less invasive approaches to dsRNA administration were assessed (Table 1). A 1 μl droplet of 0.2% Triton-X100 (v/v) placed on mites immobilised on adhesive tape rapidly killed the mites (n = 6), whereas a 1 μl droplet of dsRNA in plain water had no mortality (100% survival, n = 14), but was totally ineffective in reducing VdGST-mu1 transcript levels. Mites completely submerged in 0.2% Triton-X100 died very quickly (n = 15), whereas mites submerged in water died within a few hours (n = 15). Increasing the osmolality of the soaking solution by using 0.9% saline greatly increased survival of mites (72% survival, n = 26) submerged for 14 h at 4°C and then placed on bee pupae for a further 48 hr. This method effectively knocked down VdGST-mu1 mRNA (87 ± 0.7%, n = 3; Figure 5). It should be noted that mites removed from brood cells and placed on bee pupae in Petri dishes but receiving no treatment at all, typically exhibited survival from 75 - 90% over a 48 hr period.
Table 1. Mortality of V. destructor and the degree of gene knockdown under different RNAi experimental conditions.
thumbnailFigure 5. Effectiveness of gene-knockdown of VdGST-mu1 in V. destructor following immersion in dsRNA solution. Adult V. destructor were soaked overnight at 4°C in dsRNA in 0.9% NaCl. Mites (n = 3) were assayed by RT-PCR at 48 h post-treatment and gel loading normalized to actin.
Phenotype of VdGST-mu1 knockdown mites
To determine that the knockdown effect of treatment with either dsRNA-lacZ or dsRNA-VdGST-mu1 was not simply just at the mRNA (transcriptional) level, but was also carried through to the protein (translational) level, we assessed total GST catalytic activity in mites (Figure 6). Mites injected with dsRNA-VdGST-mu1 exhibited significantly (P < 0.05) lower GST activity rates than those injected with dsRNA-lacZ (28.1 ± 7.9 vs. 61.2 ± 12.9 FLU min-1).
thumbnailFigure 6. Total GST catalytic activity in V. destructor following VdGST-mu1 knockdown. GST activity of pairs of mites 48 h-post-injection with either VdGST-mu1 or LacZ-dsRNA measured by monitoring fluorescence of the substrate MCB over 10 min. Closed circles represent LacZ-dsRNA injected mites (n = 4) and open circles represent VdGST-mu1-dsRNA injected mites (n = 7). Data are means ± SEM.
Discussion
GSTs are a large family of multifunctional enzymes [15] that catalyse the conjugation of reduced glutathione to the electrophilic centres of lipophilic compounds rendering them water soluble, less toxic products that can be rapidly excreted from the organism's body. As such, GSTs play an important role in phase II detoxification of both endogenous and xenobiotic compounds such as pesticides. Specifically, GSTs have been shown to be involved in acaricide resistance in ticks [11,12], scabies mites [13,14] and plant mites [16]. In the present study we demonstrated the presence and tissue expression of two mu- and one kappa-class GST in V. destructor. The largest sequence fragment termed, VdGST-mu1 was 100% identical to the sequence present in an ongoing pyrosequencing project (Dr. Jay Evans, personal comm.) performed on V. destructor samples from the USA. VdGST-mu1 was present in all mite tissues assessed and was, by far, the most abundant of the three GSTs examined. VdGST-mu1 contained conserved glutathione and substrate binding residues and motifs characteristic of mu-class GSTs. However, both the mu-loop and SNAIL/TRAIL motifs were notably different from those of other acarine muGSTs. Interestingly, VdGST-mu1 was more similar to tick muGSTs than that of mites.
VdGST-mu1 was used as a test gene to assess the feasibility of dsRNAi gene knockdown in V. destructor. Essentially total suppression of VdGST-mu1 expression was achieved within 48 h after an intrahaemocoelic bolus injection of dsRNA and this suppression was maintained until at least 72 h. RNAi by injected dsRNA is an extensively employed approach for research in ticks (reviewed in [10]) and total gene knockdown can be maintained for up to, at least, 9 days [17]. However, V. destructor are considerably smaller (1 mm length × 1.5 mm width) than adult ticks and injection was only possible by pulled-glass capillary needles connected to a relatively sophisticated micro-injector system, rather than using manually operated micro-syringes as is the case for ticks and most insects. Even though the micro-injector system allowed us to demonstrate effective dsRNAi in V. destructor, survival of mites undergoing this very invasive and traumatic procedure was only 50% over a 48 h period.
Various less invasive techniques of introducing dsRNA into V. destructor were investigated that would improve speed, ease of operation, increase throughput, could be performed without expensive equipment and, most importantly, increase survivability of the treated groups. Topically applied dsRNA to immobilized mites for several hours failed to induce gene knockdown, presumably because the dsRNA was unable to cross the cuticle. We tried the addition of the detergent Triton X-100 to break the surface tension of the water allowing the dsRNA solution to become more in contact with the cuticle rather than held off it by the fine hair layer (Figure 7). However, Triton X-100 caused rapid death of the mites. Next we assessed total immersion of mites as a possible route for dsRNA administration as was previously successfully performed with salmon lice in seawater [9]. Mites immersed in 0.2% Triton X-100 died rapidly and, surprisingly, mites in distilled water died within a few hours. We postulated that the hypo-osmolarity of the distilled water caused an osmotic influx of water into the mite tissues and this was exacerbated in the presence of Triton X-100 which may have allowed water to enter through the spiracles more rapidly with the reduced water tension.
thumbnailFigure 7. Injection sites of V. destructor adult female. Arrows indicate injection sites either between the soft tissue proximal to the anal region and postcoxal plate (a), or in the soft tissue in coxal region IV (b). Scale bar = 500 μm.
Increasing the osmotic concentration of the immersion solution by using 0.9% NaCl allowed the mites to remain under solution overnight at 4°C with 75-80% survival and achieved excellent gene silencing. It is not known what is the site of dsRNA entry into the mite, but this is of considerable interest and importance. We presumed entry to be either by ingestion or though the tracheal system via the spiracles. Adult female V. destructor enter the prepupal cells 24 - 48 h before the cell is capped and they remain hidden from vigilant nurse bees by submerging themselves in the liquid brood food [18] with the peritremes surrounding the spiracles protruding from the liquid enabling the mites to breathe [19,20]. It may be possible to improve survivability and, possibly increase gene knockdown efficacy, if the osmolality of the immersion solution were increased to that of liquid brood food that is presumed to be greater than that of physiological saline (0.9% NaCl). Indeed, further optimisation of this approach could be attempted, if thought necessary, by altering immersion temperature and time, but the method presented here is a good starting point.
Not only was gene knockdown achieved at the transcriptional step (mRNA) but this was also apparent at the translational step (protein) with decreased GST catalytic activity. The apparent discrepancy between a 97% reduction in VdGST-mu1 transcript level and the 54% reduction in GST enzyme activity is because the enzyme assay detects total GST activity not just that contributed by VdGST-mu1. There have been reports of so-called "off-target" effects of RNAi whereby unintended genes sharing stretches of identical homology can be affected. A meta-analysis of dsRNAi studies in Drosophila high-throughput screens indicated that dsRNAs containing ≥ 19 nucleotide perfect matches to unintended targets can, in some instances, result in off-target effects [21]. In the case of VdGST-mu1, the most similar gene we know of in Varroa is VdGST-mu2 [EMBL Accession No.: FR675857] which shares 29% identity at the nucleotide level, but the greatest matching stretch possible is one of 12/19 nucleotides (Figure 8). Thus, it is likely that the reduction in assayable total GST activity is due to a specific knockdown of VdGST-mu1, but further studies would be necessary to confirm this. Our data would indicate that VdGST-mu1 is the predominant catalytic GST in V. destructor and highlights the specificity advantage of gene knockdown over chemical enzyme inhibitors which simultaneously affect multiple gene products.
thumbnailFigure 8. Alignment of VdGST-mu1 and VdGST-mu2 indicating stretches of perfect identity. Nucleotide sequences of VdGST-mu1 [EMBL: FR668088] and VdGST-mu2 [EMBL: FR675857] were aligned using ClustalW2 and edited in JalView Vers 2.5.1 [28] with gaps not permitted and consensus stretches shown.
Conclusions
In conclusion, we have established dsRNA knockdown in the critically important bee parasite, V. destructor, using a mu-class GST as the candidate gene. A simple, inexpensive, high throughput method of dsRNA administration was established with low mortality rates for V. destructor. This immersion approach may be applied to other small acarine pests such as scabies mites, sheep scab mites, poultry mites and plant pest mites. Additionally, the approach can be employed in ticks where the immersion approach is more convenient than injections for adult ticks but can also be applied to the smaller larval and nymphal stages which are presently not included in such gene knockdown studies. The degree of knockdown was essentially complete and persisted for several days and was apparent at both the transcript and protein level. The dsRNAi approach will allow researchers to make full use of the V. destructor gene sequences becoming available to investigate biological questions in this important parasite, notably to develop control strategies in the era when current suitable acaricides are no longer effective due to widespread resistance. Peculiarly to Varroa, because of the relatively close relatedness between the parasite and host (Varroa and bee) it is especially difficult to develop pesticides effective against the Varroa, but innocuous to the bee. In this respect, the specificity of dsRNAi may allow targeting of V. destructor genes as a control strategy, as suggested for other insect pests [22].
Methods
Mite collection and husbandry
Varroa destructor mites were collected from capped brood cells of Apis mellifera from hives in York, England that had purposefully been untreated for Varroa control. Prior to harvesting mites, the bee frames were maintained in Aberdeen at 27ºC and 40% relative humidity with a 15.5 h : 8.5 h, light:dark regime. Mites were either removed from newly emerged adult bees or from pupae following uncapping of the brood cell and extraction of the pupae. Mites were collected, bisected and placed in RNA ZR extraction buffer (Zymo Research, Orange, California, USA) and stored at -80 ºC prior to initial total RNA isolation.
RT-PCR of GSTs from V. destructor
Six adult (pharate and mobile) and 2 deutonymph mites were homogenized in 600 μl extraction buffer and total RNA prepared using a mini RNA Isolation II Kit (Zymo Research), as per manufacturer's instructions. Eluted RNA was co-precipitated with glycogen in 95% ethanol and resuspended in 10 μl of DEPC-treated water. After isolation, 2 μg total RNA was DNase treated with 2 μl (2U) RQ1-DNase (Promega, Southampton, UK) and 2 μl RQ1 buffer and incubated at 37°C for 30 min. DNase-treated total RNA (2 μg) was incubated at 70°C with 0.5 μg of oligo d(T)15 (Promega) in a total volume of 10 μl for 5 min. Material was snap-chilled on ice for 5 min prior to the addition of 5 μl 5×RT buffer, 1 μl dNTPs (25 mM each), 0.5 μl Bioscript-reverse transcriptase and DEPC water to 25 μl. The reaction was incubated at 42°C for 60 min prior to arrest by heating to 70°C for 5 min.
A V. destructor database from an ongoing pyrosequencing project (Dr. Jay Evans, pers. comm.) was mined for putative V. destructor GST sequences by BLASTx analysis using GST sequences from the deer tick, Ixodes scapularis. Of 14 putative V. destructor GST partial sequences identified, we chose three to evaluate further: two mu-class GSTs (VdGST-mu1 and VdGST-mu2) and one kappa class (VdGST-kap). These Varroa transcripts were isolated by RT-PCR using primers based on these sequences. PCR reactions consisted of 1 μl cDNA template, 5 μl 10 × reaction buffer, 2 μl 50 mM MgCl2, 1 μl dNTPs (25 mM each), 1 μl each primer (10 mM each), 0.5 μl (1.25 U) Taq (Bioline, London,UK) and DEPC-treated water to give a 50 μl total volume. Primer pairs used were VdGST-mu-F1 (CAAGTTAAATCTTGCGTTTCC) and VdGST-mu1-R1 (CTGTCCGTCTTCATGTATGC), VdGST-mu2-F1 (ACGATTTATCCGTTTTGACG) and VdGST-mu2-R2 (CCAACTGATGTGTCGTTCC), VdGST-Kap-F1 (TACTGGTGGTCGTTTCAGG) and VdGST-Kap-R1 (CTTCATAGGCCAAGAGATGC), generating products of 494, 396 and 343 bp, respectively. PCR cycling conditions were as follows: 1 cycle of 5 min at 94°C, followed by 35 cycles of 1 min at 94°C, 1 min at 53°C and 45 s at 72°C followed by a final extension time of 15 min at 72°C. Products were visualised on an agarose gel and specific bands excised and cloned into pCR4-TOPO TA vector (Invitrogen). Purified plasmids were submitted for sequencing to Eurofins MWG (Ebersberg, Germany) from flanking T7 and T3 promoter regions to confirm the original sequence data.
Bioinformatics
The GST class of the different Varroa sequences was determined by database searches and phylogenetic analysis. For VdGST-mu1, protein sequences from various acari were extracted from both non-redundant and EST databases at GenBank by tBLASTx. Additionally, the most similar GST sequences in four model insect species for which complete genomes are available were also obtained. Protein sequences were aligned in CLUSTALW2 [23]. These sequences were used to estimate phylogeny with neighbour-joining, minimum evolution and maximum parsimony methods using MEGA version 4.1 [24]. Phylogenetic trees were constructed with 10,000 bootstrap replicates.
Expression of GST transcripts in tissues of V. destructor
V. destructor mites, were removed from brood cells, as described above, and dissected under ice-cold dissection buffer (20 mM TRIS, 5 mM EDTA, 0.9% NaCl, pH 7.4). Malpighian tubules, gut and synganglia and were dissected from 20, 25 and 98 mites respectively, washed in fresh ice-cold dissection buffer and stored in 50 μl RNAlater (Sigma, Poole, UK) at -80 °C. Prior to RNA extraction, an additional 450 μl dissection buffer was added to sample tubes and centrifuged at 10,000 g for 15 min at 4°C. Supernatant was removed and tissue washed with fresh dissection buffer before a final spin at 10,000 g for 15 min at 4°C. Supernatant was discarded and 600 μl RNA ZR extraction buffer added to each tissue sample. Total RNA extraction, DNase treatment and reverse transcription were as described above. VdGST-mu1, VdGST-mu2 and VdGST-kap transcripts in tissue-specific cDNA were assayed by PCR. PCR protocol and cycling conditions were carried out using the VdGST-mu1, VdGST-mu2 and VdGST-kap primers, as described above over 30 cycles. Gel loading was normalized to V. destructor actin (VdActinF, CATCACCATTGGTAACGAG and VdActinR, CGATCCAGACGGAATACTT) generating a fragment of approximately 195 bp.
Preparation of dsRNA
VdGST-mu1-dsRNA was prepared using a BLOCK-iT RNAi TOPO transcription kit (Invitrogen), according to the manufacturer's instructions. LacZ-dsRNA was prepared and used as a negative control. Briefly, PCR was carried out as described above using adult female V. destructor cDNA in conjunction with VdGST-mu1 specific primers (VdGST-mu1 F1/R1), or with control LacZ-plasmid and LacZ specific primers (LacZ-F2, ACCAGAAGCGGTGCCGGAAA and LacZ-R2, CCACAGCGGTGGTTCGGAT). Products were resolved on an agarose gel, excised and purified using a Qiagen gel extraction kit (Qiagen, Crawley, UK). TOPO-T7 linker was ligated to VdGST-mu1 and LacZ reactions before a secondary PCR was carried out to gain sense and antisense templates. T7-RNA polymerase was used in transcription reactions with target templates to generate sense and antisense RNA. Finally, RNA strands were annealed and the resultant dsRNA purified and quantified in a micro-spectrophotometer (Nanodrop Technology Ltd). dsRNA was ethanol precipitated and resuspended in DEPC-treated water to a working concentration of 2.5 μg/μl and stored at -80°C.
Protocol of dsRNA injection and soaking
Adult female V. destructor were removed from capped brood cells along with associated bee larvae. Microinjections were carried out using pulled glass capillary needles in conjunction with a Harvard micro-injector system. Mites were placed on double-sided tape ventral side up, and injected with 20 nl (2.5 μg/μl) of either VdGST-mu1-dsRNA or LacZ-dsRNA in either the soft tissue proximal to the anal region and postcoxal plate, or in the coxa IV region, as indicated in Figure 7. Needles were left in each mite for 1 - 2 min to reduce the expulsion of fluid from the wound and withdrawn slowly. Mites were left for 1 - 2 min to allow the injection site to "seal" then returned to Petri dishes containing 1 bee larvae per 4 mites. Dead or unhealthy looking mites were removed after 1 hour and mortality was monitored over 72 h in LacZ-dsRNA, VdGSTmu1-dsRNA and non-injected mites.
To assess non-invasive techniques for dsRNA delivery, mites were either completely immersed in dsRNA or were exposed to a droplet of dsRNA on their ventral carapace. For soaking experiments, adult mites were removed from capped brood cells and placed in 500 μl microfuge tubes containing 20 μl VdGST-mu1-dsRNA or LacZ-dsRNA (2.5 μg/μl) supplemented with either nothing, 0.9% NaCl, 0.2% Triton-X100 or both. Mites were soaked at 4ºC overnight before being removed, dried and placed in Petri dishes at 27ºC, 95% relative humidity with bee larvae. Alternatively, a sample of mites was exposed to dsRNA by attaching them to double-sided tape and placing a 1 μl drop of VdGST-mu1-dsRNA or LacZ-dsRNA (2.5 μl/μg) supplemented with either nothing, 0.9% NaCl, 0.2% Triton-X100 or both on the ventral carapace. Mortality was monitored for 48 h prior to collection and validation of knockdown.
Validation of RNAi
To validate RNAi in injected, soaked and droplet-exposed adults, the total RNA was extracted from individual mites 48 h post-treatment. In addition, persistence of the RNAi effect was measured in injected mites by harvesting at 18, 24, 48 and 72 h. Total RNA was extracted from mites using mini-RNA isolation kit II, prior to DNase-treatment and reverse transcription, as described previously. PCR was carried out using either VdGST-mu1-dsRNA or LacZ-dsRNA treated sample cDNA in conjunction with primers specific for actin or VdGST-mu1 using primers and cycling conditions, as described above. Products were visualized on an agarose gel normalized to actin loading. To assess persistence and approximate % knockdown, ImageJ software was used to carry out semi-quantitative densitometric analysis on gel images.
Glutathione S-transferase activity in RNAi silenced mites
An enzymatic assay was used to assess the effect of silencing VdGST-mu1 transcript on GST enzyme activity in dsRNA-treated mites. GST activity was measured by using monochlorobimane (MCB) as the substrate, as previously described for scabies mites [25] and plant mites [26], but here we adapted it for cuvettes rather than microplates. MCB forms a stable fluorescent conjugate with reduced glutathione when catalyzed with GST. Mites injected with LacZ-dsRNA or VdGST-mu1-dsRNA were harvested 48 h post-treatment and frozen at -80ºC. Mites were grouped into pairs and homogenized by milling 2 × 30 s, with a single 3 mm tungsten bead in 175 μl of ice cold 0.05 M Tris buffer pH7.5 in a mechanical tissue disruptor (TissueLyser, Qiagen). After milling, samples were disrupted further in a sonicating water bath for 3 × 20 s with chilling in between bursts then centrifuged at 10,000 g for 5 min at 4ºC. The supernatant was retained, subjected to three freeze thaw-cycles and sonicated for a further 2 × 20 s. Samples were then centrifuged at 10,000 g for 5 min at 4ºC and 150 μl of supernatant from each sample used in the GST assay. Reduced glutathione was dissolved in 0.05 M Tris pH 7.5 and MCB dissolved in methanol and added to each reaction to a final concentration of 3 mM and 0.3 mM, respectively, in a total reaction volume of 200 μl. Mite homogenate and substrate were incubated at 37ºC for 10 min with fluorescence of GSH-bimane adduct measured every 2 s using a F4500 fluorimeter (Hitachi) with emission wavelength at 465 nm and excitation wavelength at 390 nm. All results presented were corrected for non-enzymatic fluorescence obtained from samples substituting 150 μl 0.05 M Tris for the mite material.
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
EMC participated in study conception and design, performed all the experimental work and drafted the manuscript. GEB participated in study conception, facilitated sample collection and helped draft and edit the manuscript. ASB conceived and designed the study, performed sequence analysis, statistical analysis, interpretation and drafted the manuscript. All authors read and approved the final manuscript.
Acknowledgements
We are indebted to Dr. Jay Evans and Dr. Scott Cornman, USDA-ARS Bee Research Laboratories, Beltsville, MD, USA for access to GST sequences from their Varroa sequencing project prior to its collation, analysis and annotation and publication [27]. This project was sponsored by the Scottish Beekeepers Association. We gratefully acknowledge funding from a Genesis Faraday SPARK Award, funded as part of a Scottish Government SEEKIT project; the Department for Environment, Food and Rural Affairs and the Welsh Assembly Government.
References
1.
Klein A-, Vaissière BE, Cane JH, Steffan-Dewenter I, Cunningham SA, Kremen C, Tscharntke T: Importance of pollinators in changing landscapes for world crops.
Proceedings of the Royal Society B: Biological Sciences 2007 , 274:303-313. Publisher Full Text OpenURL
Return to text
2.
van Engelsdorp D, Meixner MD: A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them.
J Invertebr Pathol 2010 , 103(SUPPL. 1):S80-S95. PubMed Abstract | Publisher Full Text OpenURL
Return to text
3.
Martin SJ: The role of varroa and viral pathogens in the collapse of honey bee colonies: A modelling approach.
J Appl Ecol 2001 , 38:1082-1093. Publisher Full Text OpenURL
Return to text
4.
Winston ML: The honey bee colony: Life history. In The hive and the honey bee. 10th edition. Edited by: Graham JM. Hamilton Illinois: Dadant & Sons; 1992. OpenURL
Return to text
5.
Martin SJ: Acaricide (pyrethroid) resistance in Varroa destructor.
Bee World 2004 , 85:67-69. OpenURL
Return to text
6.
Walshe DP, Lehane SM, Lehane MJ, Haines LR: Prolonged gene knockdown in the tsetse fly Glossina by feeding double stranded RNA.
Insect Mol Biol 2009 , 18:11-19. PubMed Abstract | Publisher Full Text OpenURL
Return to text
7.
Minakuchi C, Namiki T, Shinoda T: Krüppel homolog 1, an early juvenile hormone-response gene downstream of Methoprene-tolerant, mediates its anti-metamorphic action in the red flour beetle Tribolium castaneum.
Dev Biol 2009 , 325:341-350. PubMed Abstract | Publisher Full Text OpenURL
Return to text
8.
Shakesby AJ, Wallace IS, Isaacs HV, Pritchard J, Roberts DM, Douglas AE: A water-specific aquaporin involved in aphid osmoregulation.
Insect Biochem Mol Biol 2009 , 39:1-10. PubMed Abstract | Publisher Full Text OpenURL
Return to text
9.
Campbell EM, Pert CC, Bowman AS: RNA-interference methods for gene-knockdown in the sea louse, Lepeophtheirus salmonis: Studies on a putative prostaglandin E synthase.
Parasitology 2009 , 136:867-874. PubMed Abstract | Publisher Full Text OpenURL
Return to text
10.
de la Fuente J, Kocan KM, Almazán C, Blouin EF: RNA interference for the study and genetic manipulation of ticks.
Trends Parasitol 2007 , 23:427-433. PubMed Abstract | Publisher Full Text OpenURL
Return to text
11.
Enayati AA, Asgarian F, Amouei A, Sharif M, Mortazavi H, Boujhmehrani H, Hemingway J: Pyrethroid insecticide resistance in Rhipicephalus bursa (Acari, Ixodidae).
Pestic Biochem Physiol 2010 , 97:243-248. Publisher Full Text OpenURL
Return to text
12.
Enayati AA, Asgarian F, Sharif M, Boujhmehrani H, Amouei A, Vahedi N, Boudaghi B, Piazak N, Hemingway J: Propetamphos resistance in Rhipicephalus bursa (Acari, Ixodidae).
Vet Parasitol 2009 , 162:135-141. PubMed Abstract | Publisher Full Text OpenURL
Return to text
13.
Molin EU, Mattsson JG: Effect of acaricides on the activity of glutathione transferases from the parasitic mite Sarcoptes scabiei.
Parasitology 2008 , 135:115-123. PubMed Abstract | Publisher Full Text OpenURL
Return to text
14.
Mounsey KE, Pasay CJ, Arlian LG, Morgan MS, Holt DC, Currie BJ, Walton SF, McCarthy JS: Increased transcription of glutathione S-transferases in acaricide exposed scabies mites.
Parasites and Vectors 2010 , 3:43. PubMed Abstract | BioMed Central Full Text | PubMed Central Full Text OpenURL
Return to text
15.
Sheehan D, Meade G, Foley VM, Dowd CA: Structure, function and evolution of glutathione transferases: Implications for classification of non-mammalian members of an ancient enzyme superfamily.
Biochem J 2001 , 360:1-16. PubMed Abstract | Publisher Full Text | PubMed Central Full Text OpenURL
Return to text
16.
Stumpf N, Nauen R: Biochemical markers linked to abamectin resistance in Tetranychus urticae (Acari: Tetranychidae).
Pestic Biochem Physiol 2002 , 72:111-121. Publisher Full Text OpenURL
Return to text
17.
Campbell EM, Burdin M, Hoppler S, Bowman AS: Role of an aquaporin in the sheep tick Ixodes ricinus: Assessment as a potential control target.
Int J Parasitol 2010 , 40:15-23. PubMed Abstract | Publisher Full Text OpenURL
Return to text
18.
Sammataro D, Gerson U, Needham G: Parasitic mites of honey bees: Life history, implications, and impact. Annu Rev Entomol.
2000 , 45:519-548. PubMed Abstract | Publisher Full Text OpenURL
Return to text
19.
Bruce WA, Delfinado-Baker M, Vincenta DL: Comparative morphology of the peritremes of Varroa and Euvarroa (Varroidae), parasites of honey bees (Apidae).
Internat J Acarol 1997 , 23:13-20. Publisher Full Text OpenURL
Return to text
20.
Donzé G, Guerin PM: Time-activity budgets and space structuring by the different life stages of Varroa jacobsoni in capped brood of the honey bee, Apis mellifera.
J Insect Behav 1997 , 10:371-393. Publisher Full Text OpenURL
Return to text
21.
Kulkarni MM, Booker M, Silver SJ, Friedman A, Hong P, Perrimon N, Mathey-Prevot B: Evidence of off-target effects associated with long dsRNAs in Drosophila melanogaster cell-based assays.
Nature Methods 2006 , 3:833-838. PubMed Abstract | Publisher Full Text OpenURL
Return to text
22.
Whyard S, Singh AD, Wong S: Ingested double-stranded RNAs can act as species-specific insecticides.
Insect Biochem Mol Biol 2009 , 39:824-832. PubMed Abstract | Publisher Full Text OpenURL
Return to text
23.
Larkin MA, Blackshields G, Brown NP, Chenna R, Mcgettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG: Clustal W and Clustal X version 2.0.
Bioinformatics 2007 , 23:2947-2948. PubMed Abstract | Publisher Full Text OpenURL
Return to text
24.
Tamura K, Dudley J, Nei M, Kumar S: MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0.
sábado, 25 de diciembre de 2010
REINO UNIDO- LOS CIENTÍFICOS PODRÍAN DETENER LA DECLINACIÓN MUNDIAL DE LAS ABEJAS, FORZANDO LA AUTO DESTRUCCIÓN DEL ÁCARO VARROA
La Varroa es la principal causa de muerte de las abejas en todo el mundo, después de haber desarrollado resistencia a los medicamentos aplicados por los apicultores en la última década. En particular, se desarrolla en los fríos inviernos, cuando las colonias son más vulnerables mientras se colocan todas juntas para mantener el calor. Ahora los investigadores de la Unidad Nacional Apícola del Gobierno y la Universidad de Aberdeen, han trabajado en cómo las funciones naturales de "silencio" en un gen de los ácaros "- con el potencial para lograr su auto-destrucción. El Dr. Alan Bowman de la Universidad de Aberdeen, dijo: "La introducción de material genético inofensivos alienta la respuesta propios inmune de los ácaros para evitar que los genes de expresión de las funciones naturales. Esto podría hacer que se produzca la autodestrucción. "La belleza de este enfoque es que es específico a los objetivos de destrucción de los ácaros sin dañar a las abejas o, de hecho, ningún otro animal."
Dr Giles Budge from National Bee Unit, part of the Food and Environment Research Agency (Fera) said: “This is environment-friendly and poses no threat to the bees. With appropriate support from industry and rigorous safety testing, chemical-free medicines could be available in five to ten years.”
In developing this, scientists have used the Nobel-Prize Winning theory ‘RNA interference’, which controls the flow of genetic information. So far the ‘silencing’ process has worked with a neutral Varroa gene, which has no significant effect on the mite. But scientists now need to target a gene with the specific characteristics that are perfect to force the Varroa to self destruct.
Tests by other scientists have shown the treatment can be added to hives in bee feed. The bees move it into food for their young, where the Varroa hides.
Notes to Editors
1. The full report is available here
2. The Varroa mite originally attacked the Asian honeybee but recently jumped to the European honeybee, which has a poor natural defence. Beekeepers use chemical controls but can never eradicate it. The mite injects viruses, suppresses the bees’ immune system and feeds on blood. If untreated, or given inappropriate chemicals, it can destroy colonies.
3. RNA interference (RNAi) regulates gene expression and has greatly impacted biomedical research. Professor Andrew Fire won the 2006 Nobel Prize in Physiology or Medicine http://nobelprize.org/nobel_prizes/medicine/laureates/2006/press.html. For more information go to: http://www.nature.com/focus/rnai/animations/index.html.
4. The Food and Environment Research Agency supports and develops a sustainable food chain and healthy natural environment, and protects against biological and chemical risks. http://www.fera.defra.gov.uk/. The National Bee Unit protects advises beekeepers, supports industry, andcontrols serious pests and diseases to minimise the economic and environmental impact. https://secure.fera.defra.gov.uk/beebase/index.cfm
5. In 2009 the Government launched the Healthy Bees Plan,a 10-year strategy to protect and improve the health of honeybees in England and Wales. To help it start, Defra and the Welsh Assembly Government (WAG) contributed £2.8million up to 2011.
6. In June 2010, Defra and WAG contributed £2.5million to the Insect Pollinators Initiative for research into understanding and mitigating the biological and environmental factors affecting insect pollinators.
7. In October Defra announced support for the British Beekeeping Association to increase the number of quality trainers for beekeepers across England and Wales. This is to teach amateurs the skills to care for bees and guard against pests and diseases.
Dr Giles Budge from National Bee Unit, part of the Food and Environment Research Agency (Fera) said: “This is environment-friendly and poses no threat to the bees. With appropriate support from industry and rigorous safety testing, chemical-free medicines could be available in five to ten years.”
In developing this, scientists have used the Nobel-Prize Winning theory ‘RNA interference’, which controls the flow of genetic information. So far the ‘silencing’ process has worked with a neutral Varroa gene, which has no significant effect on the mite. But scientists now need to target a gene with the specific characteristics that are perfect to force the Varroa to self destruct.
Tests by other scientists have shown the treatment can be added to hives in bee feed. The bees move it into food for their young, where the Varroa hides.
Notes to Editors
1. The full report is available here
2. The Varroa mite originally attacked the Asian honeybee but recently jumped to the European honeybee, which has a poor natural defence. Beekeepers use chemical controls but can never eradicate it. The mite injects viruses, suppresses the bees’ immune system and feeds on blood. If untreated, or given inappropriate chemicals, it can destroy colonies.
3. RNA interference (RNAi) regulates gene expression and has greatly impacted biomedical research. Professor Andrew Fire won the 2006 Nobel Prize in Physiology or Medicine http://nobelprize.org/nobel_prizes/medicine/laureates/2006/press.html. For more information go to: http://www.nature.com/focus/rnai/animations/index.html.
4. The Food and Environment Research Agency supports and develops a sustainable food chain and healthy natural environment, and protects against biological and chemical risks. http://www.fera.defra.gov.uk/. The National Bee Unit protects advises beekeepers, supports industry, andcontrols serious pests and diseases to minimise the economic and environmental impact. https://secure.fera.defra.gov.uk/beebase/index.cfm
5. In 2009 the Government launched the Healthy Bees Plan,a 10-year strategy to protect and improve the health of honeybees in England and Wales. To help it start, Defra and the Welsh Assembly Government (WAG) contributed £2.8million up to 2011.
6. In June 2010, Defra and WAG contributed £2.5million to the Insect Pollinators Initiative for research into understanding and mitigating the biological and environmental factors affecting insect pollinators.
7. In October Defra announced support for the British Beekeeping Association to increase the number of quality trainers for beekeepers across England and Wales. This is to teach amateurs the skills to care for bees and guard against pests and diseases.
MICROCÁPSULAS DE PROPOLEO PARA LA CONSERVACIÓN DE LSO ALIMENTOS
Aunque los científicos saben que el propóleos puede ayudar a conservar los alimentos, el añadir no es una solución aceptada por todos. El equipo de la profesora Carmen Silvia Favaro del Colégio de la Trinidad de Ciencia Animal y de Ingeniería de Alimentos (FZEA), USP, encuentró una solución: poner el propóleo en cápsulas microscópicas. El proceso de microencapsulación transforma las dimensiones de las cápsulas de propóleo invisibles a simple vista, el orden de 2 a 100 micrómetros (IM). "Debido a las dimensiones tan pequeñas, se obtienen cantidades de polvo con las microcápsulas. Este polvo se introduce en la comida. La microencapsulación redujo el fuerte olor a resina y suavizó su sabor amargo. Por otra parte, se convirtió en el producto soluble en agua ", explica la profesora Carmen
Las ayudas a la mejora de la producción y comercialización apícola en Extremadura podrán subvencionar hasta 500 colmenas
Las ayudas a la mejora de la producción y comercialización de los productos de la apicultura en Extremadura, que se someterán al procedimiento de concurrencia competitiva, podrán llegar a subvencionar hasta un máximo de 500 colmenas.
Las ayudas a la mejora de la producción y comercialización apícola en Extremadura podrán subvencionar hasta 500 colmenas
Ampliar foto
El Diario Oficial de Extremadura publica este jueves 16 de diciembre el decreto que regula estas ayudas, el cual adapta la normativa al nuevo Plan Nacional Apícola para el trienio 2011-2013 aprobado por la Comisión en el mes de septiembre.
El nuevo decreto ha sido consensuado con las Organizaciones Profesionales Agrarias y recoge las novedades introducidas por el programa nacional respecto a los requisitos para percibir las ayudas y las actuaciones que pueden acogerse a las subvenciones, según informa la Junta de Extremadura en nota de prensa.
En cuanto a las condiciones para percibir las ayudas, podrán ser beneficiarios los titulares de explotaciones apícolas que, entre otros requisitos, tengan inscritas sus colmenas en el Registro Autonómico de Explotaciones, realicen tratamientos contra la enfermedad de la varroasis y tengan seguro de daños y responsabilidad civil para sus colmenas.
Además, las actuaciones que contemplan las ayudas autonómicas tienen que ir dirigidas a facilitar la asistencia técnica a los apicultores y agrupaciones de apicultores, a la lucha contra la varroasis, a medidas encaminadas a la racionalización de la trashumancia y al apoyo a los laboratorios de análisis de las características de la miel.
Por tanto, la Junta añade que será subvencionable la realización de actividades formativas, la contratación de personal técnico y especialista y los costes de medicamentos, así como los derivados del traslado de colmenas y la compra de material de análisis.
La convocatoria de ayudas para el próximo año 2011, que se regirá por este nuevo decreto, se aprobará en breve y contará con un presupuesto de más de 1,5 millones de euros.
Las ayudas a la mejora de la producción y comercialización apícola en Extremadura podrán subvencionar hasta 500 colmenas
Ampliar foto
El Diario Oficial de Extremadura publica este jueves 16 de diciembre el decreto que regula estas ayudas, el cual adapta la normativa al nuevo Plan Nacional Apícola para el trienio 2011-2013 aprobado por la Comisión en el mes de septiembre.
El nuevo decreto ha sido consensuado con las Organizaciones Profesionales Agrarias y recoge las novedades introducidas por el programa nacional respecto a los requisitos para percibir las ayudas y las actuaciones que pueden acogerse a las subvenciones, según informa la Junta de Extremadura en nota de prensa.
En cuanto a las condiciones para percibir las ayudas, podrán ser beneficiarios los titulares de explotaciones apícolas que, entre otros requisitos, tengan inscritas sus colmenas en el Registro Autonómico de Explotaciones, realicen tratamientos contra la enfermedad de la varroasis y tengan seguro de daños y responsabilidad civil para sus colmenas.
Además, las actuaciones que contemplan las ayudas autonómicas tienen que ir dirigidas a facilitar la asistencia técnica a los apicultores y agrupaciones de apicultores, a la lucha contra la varroasis, a medidas encaminadas a la racionalización de la trashumancia y al apoyo a los laboratorios de análisis de las características de la miel.
Por tanto, la Junta añade que será subvencionable la realización de actividades formativas, la contratación de personal técnico y especialista y los costes de medicamentos, así como los derivados del traslado de colmenas y la compra de material de análisis.
La convocatoria de ayudas para el próximo año 2011, que se regirá por este nuevo decreto, se aprobará en breve y contará con un presupuesto de más de 1,5 millones de euros.
Los productores de Liébana apoyan la denominación de origen para la miel
Los productores de miel de Liébana han iniciado los trámites para conseguir la Denominación de Origen Protegida 'Miel de Liébana'. La Oficina de Calidad Alimentaria de Cantabria (Odeca) está elaborando los documentos y analizando anualmente las muestras de miel de los productores de Liébana para poder definir las características polinológicas generales y particulares de la miel de la comarca. Además, en su solicitud debe describirse el producto, la zona geográfica, su vinculación a la flora característica de Liébana para que se produzca ese tipo de miel y los métodos de obtención del producto y de su envasado. Se ha encargado también a la Universidad de Cantabria un estudio sobre la vinculación histórica de la miel a la comarca, que incluirá documentos históricos como aquellos en los que se registra el pago con cera en el siglo XVI. Toda esta documentación deberá aportarse para tramitar, tanto a nivel nacional como ante las instituciones europeas, la denominación de origen protegida para la miel de Liébana.
Los productores de miel de la comarca están muy satisfechos con los pasos que se están realizando, y no dudan de que conseguir la denominación será fundamental para sus empresas y evitar el fraude. Para Rubén Varona, productor de 'Miel Colmenares de Vendejo', «No cabe duda que para las personas que presentamos un producto de calidad al consumidor, la denominación de origen es un paso muy importante en la lucha contra el fraude en nuestro producto».
En los mismos términos también se muestra María López, de 'Miel Valle Estrechu', para quien «la denominación beneficiará tanto al nombre de Liébana como a nuestro producto. Hay mucho intrusismo aprovechando el tirón turístico que tiene la comarca sobre todo en las épocas vacacionales, y nos perjudica mucho, porque no cabe duda de que la miel pierde prestigio. Los productores apoyamos decididamente la denominación».
María Dolores Gutiérrez, de 'Miel Sierra Tama', cree que «éste es el paso para dar prestigio a nuestro producto y evitar el fraude. No cabe duda de que sería una garantía para los consumidores, ya que no es igual una miel envasada en Liébana, que producida en la comarca».
Los productores de miel de la comarca están muy satisfechos con los pasos que se están realizando, y no dudan de que conseguir la denominación será fundamental para sus empresas y evitar el fraude. Para Rubén Varona, productor de 'Miel Colmenares de Vendejo', «No cabe duda que para las personas que presentamos un producto de calidad al consumidor, la denominación de origen es un paso muy importante en la lucha contra el fraude en nuestro producto».
En los mismos términos también se muestra María López, de 'Miel Valle Estrechu', para quien «la denominación beneficiará tanto al nombre de Liébana como a nuestro producto. Hay mucho intrusismo aprovechando el tirón turístico que tiene la comarca sobre todo en las épocas vacacionales, y nos perjudica mucho, porque no cabe duda de que la miel pierde prestigio. Los productores apoyamos decididamente la denominación».
María Dolores Gutiérrez, de 'Miel Sierra Tama', cree que «éste es el paso para dar prestigio a nuestro producto y evitar el fraude. No cabe duda de que sería una garantía para los consumidores, ya que no es igual una miel envasada en Liébana, que producida en la comarca».
CEE- BAYER ESTÁ TRABAJANDO PARA PROBAR UNA SOLUCIÓN PARA EL CONTROL DE LA VARROA-
Progresando con su promesa de traer a los apicultores europeos una solución eficaz para controlar el ácaro Varroa destructor, BASF y Productos NOD anunciaron los primeros resultados de los ensayos del registro oficial llevados a cabo en Europa. Las pruebas realizadas con la ayuda de científicos apícolas independientes en Alemania, Francia y el Reino Unido fueron prometedores. En todos los países, los ensayos se llevaron a cabo en colaboración con los institutos locales. En Alemania, BASF y NOD se asociaron con el Instituto Estatal de Apicultura (Universidad de Hohenheim). En el Reino Unido y Francia, los ensayos se realizaron con lla Agencia de Investigación Ambiental (Fera) y en TESTAPI (experimento de la abeja y consultoría), respectivamente. Desde julio 2010 hasta octubre 2010, BASF probó dos formulaciones de productos diferentes en Europa. Una de estas formulaciones mostró la eficacia del producto destacado: Como resultado de estos ensayos de 2010, BASF espera un nivel de eficacia del producto consistente por encima del 90%.
domingo, 5 de diciembre de 2010
La llegada del avispón asiático pone en alerta a los apicultores gallegos
Ha aparecido en Irún y su especialidad es la caza de abejas al vuelo. Devora colmenas enteras y es más peligroso que la autóctona «Vespa cabro», que atacó en Ourense
La aparición en Irún de la avispa asiática Vespa velutina nigritorax ha puesto en alerta a los apicultores gallegos, puesto que su expansión ha sido rápida desde su detección en Francia en el 2005. Según el instituto vasco Neiker de investigación agraria, llegó en un contenedor chino al puerto de Burdeos y pronto se ha expandido por más de 30 departamentos franceses, donde es un voraz depredador de abejas melíferas autóctonas. Al no ser un enemigo natural, sino introducido, aún no han desarrollado una estrategia de defensa eficaz como para hacerles frente. Sus parientes abejas asiáticas, Apis cerana, sí son capaces de rodearlas y elevar la temperatura hasta matar a las intrusas en las colmenas.
El avispón asiático, originario de China, la India e Indonesia, triplica en tamaño a la abeja europea y se distingue fácilmente del avispón autóctono Vespa cabro, ya que este tiene el tórax rojizo y el abdomen negro y amarillo, mientras que el abdomen del invasor es de color negro o marrón oscuro (excepto una franja caudal amarilla) y en la cabeza negra su frente es anaranjada. Los extremos de sus patas también son amarillentos. «Aquí de momento non chegou, pero imos organizar unha rede de alerta e contactaremos cos colegas vascos», dice la veterinaria Ester Ordóñez, presidenta de Mel de Galicia y de la Asociación Galega de Apicultores.
«Tivemos avisos -añade Ordóñez-, na zona de Bande (Ourense) sobre avespas algo máis grandes do habitual, pero son as daquí, que poden matar dúas ou tres abellas. As asiáticas realmente arrasan as colmeas». Esta veterinaria no desdeña el peligro que puedan suponer para la apicultura si son capaces de adaptarse al clima del norte de la Península, y recuerda que aún hoy se deben tratar las colmenas con medicamentos para defenderlas de la varroa, un ácaro procedente del sudeste asiático detectado en Grecia en 1975 y que diez años más tarde ya invadió la cabaña apícola española. La varroasis es hoy el principal problema sanitario junto al más reciente y no aclarado síndrome de despoblamiento.
Difícil control
Al igual que las avispas europeas (en España hay unas 30 especies de véspidos), las asiáticas son carnívoras y cazan de día las abejas obreras. Las decapitan con sus mandíbulas y con ellas alimentan a sus larvas. También devoran las crías de abeja dentro del enjambre. Poseen aguijón y el hecho de que aniden en lo alto de los árboles, en colonias de más de mil individuos, complica su control. No obstante, bomberos o apicultores suelen conocer el manejo de la Vespa cabro, no muy común, pero que ataca igualmente con agresividad si es molestada.
Unas y otras son beneficiosas para la polinización y controlan otras plagas pero, consciente del recelo que generan abejas y avispas en las personas, Ester Ordóñez dice que las primeras pican solo al defender su territorio. «O normal é que as picaduras sexan de avispas, máis agresivas no verán». La mayoría de casos atendidos son al practicar actividades de ocio o trabajar en el campo. Se desaconsejan movimientos bruscos ante ellas, llevar ropas claras u olores fuertes, comer y cocinar al aire libre.
Evitar riesgos
Los niños pueden ser más propensos a recibir picaduras por su curiosidad con los bichos y actividad en piscinas, frecuentadas por avispas. Sus casos no revisten mayor gravedad que en adultos pero hay que distinguir entre las merodeadoras y las de avisperos próximos a colegios o parques. La picadura puede provocar dificultad para respirar, vómitos, mareos, desvanecimiento, caída de tensión arterial o un choque anafiláctico fatal si no se trata con rapidez. La prevención es la vacuna antialérgica específica tras reaccionar mal ante una picadura. Se calculan en más de 800.000 los alérgicos españoles al veneno de insectos.
La aparición en Irún de la avispa asiática Vespa velutina nigritorax ha puesto en alerta a los apicultores gallegos, puesto que su expansión ha sido rápida desde su detección en Francia en el 2005. Según el instituto vasco Neiker de investigación agraria, llegó en un contenedor chino al puerto de Burdeos y pronto se ha expandido por más de 30 departamentos franceses, donde es un voraz depredador de abejas melíferas autóctonas. Al no ser un enemigo natural, sino introducido, aún no han desarrollado una estrategia de defensa eficaz como para hacerles frente. Sus parientes abejas asiáticas, Apis cerana, sí son capaces de rodearlas y elevar la temperatura hasta matar a las intrusas en las colmenas.
El avispón asiático, originario de China, la India e Indonesia, triplica en tamaño a la abeja europea y se distingue fácilmente del avispón autóctono Vespa cabro, ya que este tiene el tórax rojizo y el abdomen negro y amarillo, mientras que el abdomen del invasor es de color negro o marrón oscuro (excepto una franja caudal amarilla) y en la cabeza negra su frente es anaranjada. Los extremos de sus patas también son amarillentos. «Aquí de momento non chegou, pero imos organizar unha rede de alerta e contactaremos cos colegas vascos», dice la veterinaria Ester Ordóñez, presidenta de Mel de Galicia y de la Asociación Galega de Apicultores.
«Tivemos avisos -añade Ordóñez-, na zona de Bande (Ourense) sobre avespas algo máis grandes do habitual, pero son as daquí, que poden matar dúas ou tres abellas. As asiáticas realmente arrasan as colmeas». Esta veterinaria no desdeña el peligro que puedan suponer para la apicultura si son capaces de adaptarse al clima del norte de la Península, y recuerda que aún hoy se deben tratar las colmenas con medicamentos para defenderlas de la varroa, un ácaro procedente del sudeste asiático detectado en Grecia en 1975 y que diez años más tarde ya invadió la cabaña apícola española. La varroasis es hoy el principal problema sanitario junto al más reciente y no aclarado síndrome de despoblamiento.
Difícil control
Al igual que las avispas europeas (en España hay unas 30 especies de véspidos), las asiáticas son carnívoras y cazan de día las abejas obreras. Las decapitan con sus mandíbulas y con ellas alimentan a sus larvas. También devoran las crías de abeja dentro del enjambre. Poseen aguijón y el hecho de que aniden en lo alto de los árboles, en colonias de más de mil individuos, complica su control. No obstante, bomberos o apicultores suelen conocer el manejo de la Vespa cabro, no muy común, pero que ataca igualmente con agresividad si es molestada.
Unas y otras son beneficiosas para la polinización y controlan otras plagas pero, consciente del recelo que generan abejas y avispas en las personas, Ester Ordóñez dice que las primeras pican solo al defender su territorio. «O normal é que as picaduras sexan de avispas, máis agresivas no verán». La mayoría de casos atendidos son al practicar actividades de ocio o trabajar en el campo. Se desaconsejan movimientos bruscos ante ellas, llevar ropas claras u olores fuertes, comer y cocinar al aire libre.
Evitar riesgos
Los niños pueden ser más propensos a recibir picaduras por su curiosidad con los bichos y actividad en piscinas, frecuentadas por avispas. Sus casos no revisten mayor gravedad que en adultos pero hay que distinguir entre las merodeadoras y las de avisperos próximos a colegios o parques. La picadura puede provocar dificultad para respirar, vómitos, mareos, desvanecimiento, caída de tensión arterial o un choque anafiláctico fatal si no se trata con rapidez. La prevención es la vacuna antialérgica específica tras reaccionar mal ante una picadura. Se calculan en más de 800.000 los alérgicos españoles al veneno de insectos.
EE.UU.- ABEJAS CON RAYAS MISTERIOSAS DE COLOR ROJO EN NUEVA YORK
Donde debería haber habido un toque de color ámbar suave que se ve a través de la membrana de los estómagos, había más bien un color rojo brillante chillon. Los panales, también, eran una sombra alarmante de color rojo. "Pensé que tal vez venía algún tipo de árbol raro, tal vez un zumaque", dijo Mayo, que tiende siete colmenas de valor añadido, una educación sin fines de lucro en Red Hook. "Estamos desconcertados." Un conocido, en broma, propuso lo impensable: Tal vez las abejas estaban tomando el jugo - el jugo de cereza marrasquino, cosa dulce y pegajosa que está en las cubas de la empresa Dell Cerezas sobre el Dikeman Street en Red Hook.
APICULTOR RECIBE UN PRÉMIO EN LAS ISLAS BALEARES
Las explotaciones agrarias *Biniseguí Vell i Nou SRM, la finca Binillubet SRM y el apicultor profesional Sebastià Pons Pons han recibido hoy de manos de la consellera de Economía y Medio ambiente, Antònia Allès, el V Premio al esfuerzo en la gestión de las explotaciones agrarias que han llevado a cabo sus actividades con prácticas agroambientales. En el caso del premio en la modalidad del fomento de la polinización, Sebastià Pons Pons destacó para tener el mayor número de casetas de abejas instaladas en el mayor número de fincas rústicas y también para pertenecer a la marca de garantía Miel de Menorca.
Instalan estaciones polinizadoras para abejas silvestres
EUROPA PRESS El área de Medio Ambiente de la Diputación de Alicante ha puesto en marcha diversas estaciones polinizadoras para abejas silvestres en su Red Provincial de Espacios Naturales con el objetivo "de potenciar la biodiversidad en la provincia", según ha informado en un comunicado la institución provincial.
Esta iniciativa cuenta con la instalación de seis colmenas artesanales para favorecer el asentamiento de enjambres de abejas silvestres, que contribuirán a la polinización de las plantas del entorno en el que se encuentran, y para la protección del insecto.
Este método de reproducción de la flora permite "la proliferación de más especies" y constituye "una herramienta para la recuperación de zonas degradadas", por ejemplo, tras un incendio, debido a que "favorecen el rápido crecimiento de plantas que frenan la erosión del suelo y retienen el agua".
A estas acciones se le suma una labor de educación ambiental para los escolares de la provincia. Alicante Natura, encargada de la Red Provincial de Espacios Naturales de la Diputación, ha instalado en Casa Tápena de Onil (Alicante) una colmena didáctica en el interior de una urna donde los alumnos pueden conocer en vivo el modo de vida de las abejas, su organización, el papel que realizan en la naturaleza y los productos que se obtienen a partir de ellas.
El gerente del área de Medio Ambiente, Alejandro de la Vega, ha destacado que "desde que se instaló esta colmena viva, ha sido una de las principales atracciones para los escolares que visitan Casa Tápena", donde los niños "se asombran al descubrir cómo es realmente una colonia de abejas, cómo son sus panales, cómo acumulan la miel en las celdillas e, incluso, la comunicación que existe entre estos insectos".
COMPARTIR
¿qué es esto?
Enviar
Suscribirse a:
Comentarios (Atom)